Hi Kathylea, DNA is more than 99% similar between any two people. All the differences in how we look, feel, behave and the differences in our health are due to less than 1% difference.
DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.
Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA
It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.
So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.
You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.
We see the same thing between humans and apes. We share more than 90% of our DNA with chimpanzees, but there a lot of differences between us. This is because the last common ancestor of humans and chimps was many millions of years ago, so a lot of changes to the DNA have occurred since that time.
Very similar DNA between people – on that level we’re all related. The genetic similarity to your parents is just particularly close.
It’s amazing to think, when you walk down the street and look around you at how different everyone looks, that we share so much of the same DNA – that there are so few variations. One of the reasons this is not so surprising when you look into it is that your body is an amazingly complex thing, and most of the DNA goes into making it work. So the chemical cogs and gears and stuff making you tick – all that stuff has been finely tuned and the DNA for those things is kept pretty constant (it’s “highly conserved”). The stuff that governs your appearance – that can change quite a bit without really affecting too much else. Doesn’t matter if I have different colour eyes, but change a gene that helps make one of my important enzymes, and things might not work quite so well.
We’re about 85% similar to a MOUSE. OK, so we don’t have the set of genes for a tail and cute little whiskers, but hey, all the other stuff is the same. The way the blood works, the way we process food, the way we build nerves. It’s like cars – under the hood – very similar. Up on top, can be all different kinds of designs.
Aimee and Matt have great answers. Very little to add from me, except to say that minute difference between one person and another person is what makes DNA matching possible.
Hi Kathylea, DNA is more than 99% similar between any two people. All the differences in how we look, feel, behave and the differences in our health are due to less than 1% difference.
DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.
Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA
It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.
So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.
You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.
We see the same thing between humans and apes. We share more than 90% of our DNA with chimpanzees, but there a lot of differences between us. This is because the last common ancestor of humans and chimps was many millions of years ago, so a lot of changes to the DNA have occurred since that time.
0
Very similar DNA between people – on that level we’re all related. The genetic similarity to your parents is just particularly close.
It’s amazing to think, when you walk down the street and look around you at how different everyone looks, that we share so much of the same DNA – that there are so few variations. One of the reasons this is not so surprising when you look into it is that your body is an amazingly complex thing, and most of the DNA goes into making it work. So the chemical cogs and gears and stuff making you tick – all that stuff has been finely tuned and the DNA for those things is kept pretty constant (it’s “highly conserved”). The stuff that governs your appearance – that can change quite a bit without really affecting too much else. Doesn’t matter if I have different colour eyes, but change a gene that helps make one of my important enzymes, and things might not work quite so well.
We’re about 85% similar to a MOUSE. OK, so we don’t have the set of genes for a tail and cute little whiskers, but hey, all the other stuff is the same. The way the blood works, the way we process food, the way we build nerves. It’s like cars – under the hood – very similar. Up on top, can be all different kinds of designs.
0
Aimee and Matt have great answers. Very little to add from me, except to say that minute difference between one person and another person is what makes DNA matching possible.
0